Peritrich nuclear code
Nuclear genetic code in some ciliates
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.
01The code (30)
- AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
- Starts = --------------*--------------------M----------------------------
- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
- Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
- Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
02Differences from the standard code
| DNA codons | RNA codons | This code (30) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Glu (E) | Ter (*) | |
| TAG | UAG | Glu (E) | Ter (*) |
Sources and credits
This article is adapted from the Wikipedia article “Peritrich nuclear code”, written by its contributors and licensed under CC BY-SA 4.0. Fathomly has changed the layout, removed citation markers, navigation and maintenance notices, and adjusted punctuation. This adapted version is shared under the same license. For references, see the original article.
Fathomly is not affiliated with or endorsed by the Wikimedia Foundation. Spotted a problem? Tell us.