Alternative flatworm mitochondrial code
Alternative genetic code
The alternative flatworm mitochondrial code (translation table 14) is a genetic code found in the mitochondria of Platyhelminthes and Nematodes.
01Code
- AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGG
- Starts = -----------------------------------M----------------------------
- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
- Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
- Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
02Differences from the standard code
| DNA codons | RNA codons | This code (14) | Standard code (1) | |
|---|---|---|---|---|
| AAA | AAA | Asn (N) | Lys (K) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| TAA | UAA | Tyr (Y) | STOP = Ter (*) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
03Systematic range and comments
- Platyhelminthes (flatworms) and Nematoda (roundworms).
Code 14 differs from code 9 (the echinoderm and flatworm mitochondrial code) only by translating UAA to Tyr rather than STOP. A study in 2000 has found no evidence that the codon UAA codes for Tyr in the flatworms but other opinions exist. There are very few GenBank records that are translated with code 14 but a test translation shows that re-translating these records with code 9 can cause premature terminations. More recently, UAA has been found to code for tyrosine in the nematodes Radopholus similis and Radopholus arabocoffeae.
Sources and credits
This article is adapted from the Wikipedia article “Alternative flatworm mitochondrial code”, written by its contributors and licensed under CC BY-SA 4.0. Fathomly has changed the layout, removed citation markers, navigation and maintenance notices, and adjusted punctuation. This adapted version is shared under the same license. For references, see the original article.
Fathomly is not affiliated with or endorsed by the Wikimedia Foundation. Spotted a problem? Tell us.